Changes
On June 14, 2024 at 12:55:37 PM UTC,
-
No fields were updated. See the metadata diff for more details.
f | 1 | { | f | 1 | { |
2 | "author": "[{\"affiliation\": \"WSL\", \"affiliation_02\": \"\", | 2 | "author": "[{\"affiliation\": \"WSL\", \"affiliation_02\": \"\", | ||
3 | \"affiliation_03\": \"\", \"email\": \"merin.chacko@wsl.ch\", | 3 | \"affiliation_03\": \"\", \"email\": \"merin.chacko@wsl.ch\", | ||
4 | \"given_name\": \"Merin\", \"identifier\": \"0000-0002-6069-4281\", | 4 | \"given_name\": \"Merin\", \"identifier\": \"0000-0002-6069-4281\", | ||
5 | \"name\": \"Reji Chacko\"}, {\"affiliation\": \"Univ Zurich\", | 5 | \"name\": \"Reji Chacko\"}, {\"affiliation\": \"Univ Zurich\", | ||
6 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | 6 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | ||
7 | \"florian.altermatt@ieu.uzh.ch\", \"given_name\": \"Florian\", | 7 | \"florian.altermatt@ieu.uzh.ch\", \"given_name\": \"Florian\", | ||
8 | \"identifier\": \"\", \"name\": \"Altermatt\"}, {\"affiliation\": | 8 | \"identifier\": \"\", \"name\": \"Altermatt\"}, {\"affiliation\": | ||
9 | \"WSL\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | 9 | \"WSL\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | ||
10 | \"email\": \"fabian.fopp@wsl.ch\", \"given_name\": \"Fabian\", | 10 | \"email\": \"fabian.fopp@wsl.ch\", \"given_name\": \"Fabian\", | ||
11 | \"identifier\": \"0000-0003-0648-8484\", \"name\": \"Fopp\"}, | 11 | \"identifier\": \"0000-0003-0648-8484\", \"name\": \"Fopp\"}, | ||
12 | {\"affiliation\": \"University of Lausanne\", \"affiliation_02\": | 12 | {\"affiliation\": \"University of Lausanne\", \"affiliation_02\": | ||
13 | \"\", \"affiliation_03\": \"\", \"email\": \"antoine.guisan@unil.ch\", | 13 | \"\", \"affiliation_03\": \"\", \"email\": \"antoine.guisan@unil.ch\", | ||
14 | \"given_name\": \"Antoine\", \"identifier\": \"0000-0002-3998-4815\", | 14 | \"given_name\": \"Antoine\", \"identifier\": \"0000-0002-3998-4815\", | ||
15 | \"name\": \"Guisan\"}, {\"affiliation\": \"WSL, ETH\", | 15 | \"name\": \"Guisan\"}, {\"affiliation\": \"WSL, ETH\", | ||
16 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | 16 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | ||
17 | \"thomas.keggin@usys.ethz.ch\", \"given_name\": \"Thomas\", | 17 | \"thomas.keggin@usys.ethz.ch\", \"given_name\": \"Thomas\", | ||
18 | \"identifier\": \"\", \"name\": \"Keggin\"}, {\"affiliation\": | 18 | \"identifier\": \"\", \"name\": \"Keggin\"}, {\"affiliation\": | ||
19 | \"WWF\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | 19 | \"WWF\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | ||
20 | \"email\": \"Arnaud.Lyet@wwfus.org\", \"given_name\": \"Arnaud\", | 20 | \"email\": \"Arnaud.Lyet@wwfus.org\", \"given_name\": \"Arnaud\", | ||
21 | \"identifier\": \"\", \"name\": \"Lyet\"}, {\"affiliation\": \"Univ | 21 | \"identifier\": \"\", \"name\": \"Lyet\"}, {\"affiliation\": \"Univ | ||
22 | Lausanne\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | 22 | Lausanne\", \"affiliation_02\": \"\", \"affiliation_03\": \"\", | ||
23 | \"email\": \"Pierre-Louis.Rey@unil.ch\", \"given_name\": | 23 | \"email\": \"Pierre-Louis.Rey@unil.ch\", \"given_name\": | ||
24 | \"Pierre-Louis\", \"identifier\": \"\", \"name\": \"Rey\"}, | 24 | \"Pierre-Louis\", \"identifier\": \"\", \"name\": \"Rey\"}, | ||
25 | {\"affiliation\": \"ETHZ\", \"affiliation_02\": \"\", | 25 | {\"affiliation\": \"ETHZ\", \"affiliation_02\": \"\", | ||
26 | \"affiliation_03\": \"\", \"email\": \"eilish.richards@usys.ethz.ch\", | 26 | \"affiliation_03\": \"\", \"email\": \"eilish.richards@usys.ethz.ch\", | ||
27 | \"given_name\": \"Eil\\u00edsh\", \"identifier\": \"\", \"name\": | 27 | \"given_name\": \"Eil\\u00edsh\", \"identifier\": \"\", \"name\": | ||
28 | \"Richards\"}, {\"affiliation\": \"SPYGEN\", \"affiliation_02\": \"\", | 28 | \"Richards\"}, {\"affiliation\": \"SPYGEN\", \"affiliation_02\": \"\", | ||
29 | \"affiliation_03\": \"\", \"email\": \"alice.valentini@spygen.com\", | 29 | \"affiliation_03\": \"\", \"email\": \"alice.valentini@spygen.com\", | ||
30 | \"given_name\": \"Alice\", \"identifier\": \"\", \"name\": | 30 | \"given_name\": \"Alice\", \"identifier\": \"\", \"name\": | ||
31 | \"Valentini\"}, {\"affiliation\": \"Unit of Land Change Science, Swiss | 31 | \"Valentini\"}, {\"affiliation\": \"Unit of Land Change Science, Swiss | ||
32 | Federal Research Institute WSL, Birmensdorf, Switzerland\", | 32 | Federal Research Institute WSL, Birmensdorf, Switzerland\", | ||
33 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | 33 | \"affiliation_02\": \"\", \"affiliation_03\": \"\", \"email\": | ||
34 | \"conor.waldock@unibe.ch\", \"given_name\": \"Conor\", \"identifier\": | 34 | \"conor.waldock@unibe.ch\", \"given_name\": \"Conor\", \"identifier\": | ||
35 | \"0000-0002-2818-9859\", \"name\": \"Waldock\"}, {\"affiliation\": | 35 | \"0000-0002-2818-9859\", \"name\": \"Waldock\"}, {\"affiliation\": | ||
36 | \"Landscape Ecology, Institute of Terrestrial Ecosystems, ETH | 36 | \"Landscape Ecology, Institute of Terrestrial Ecosystems, ETH | ||
37 | Z\\u00fcrich, 8049 Z\\u00fcrich, Switzerland\", \"affiliation_02\": | 37 | Z\\u00fcrich, 8049 Z\\u00fcrich, Switzerland\", \"affiliation_02\": | ||
38 | \"\", \"affiliation_03\": \"\", \"email\": \"loic.pellissier@wsl.ch\", | 38 | \"\", \"affiliation_03\": \"\", \"email\": \"loic.pellissier@wsl.ch\", | ||
39 | \"given_name\": \"Loic\", \"identifier\": \"0000-0002-2289-8259\", | 39 | \"given_name\": \"Loic\", \"identifier\": \"0000-0002-2289-8259\", | ||
40 | \"name\": \"Pellissier\"}]", | 40 | \"name\": \"Pellissier\"}]", | ||
41 | "author_email": null, | 41 | "author_email": null, | ||
42 | "creator_user_id": "382d8fab-f378-477d-88f6-26f77aee50d8", | 42 | "creator_user_id": "382d8fab-f378-477d-88f6-26f77aee50d8", | ||
43 | "date": "[{\"date\": \"2020-06-22\", \"date_type\": \"created\", | 43 | "date": "[{\"date\": \"2020-06-22\", \"date_type\": \"created\", | ||
44 | \"end_date\": \"2020-06-26\"}, {\"date\": \"2020-06-22\", | 44 | \"end_date\": \"2020-06-26\"}, {\"date\": \"2020-06-22\", | ||
45 | \"date_type\": \"collected\", \"end_date\": \"2020-06-26\"}]", | 45 | \"date_type\": \"collected\", \"end_date\": \"2020-06-26\"}]", | ||
46 | "doi": "10.16904/envidat.445", | 46 | "doi": "10.16904/envidat.445", | ||
47 | "extras": [ | 47 | "extras": [ | ||
48 | { | 48 | { | ||
49 | "key": "edna_type", | 49 | "key": "edna_type", | ||
50 | "value": "freshwater" | 50 | "value": "freshwater" | ||
51 | }, | 51 | }, | ||
52 | { | 52 | { | ||
53 | "key": "metadata", | 53 | "key": "metadata", | ||
54 | "value": | 54 | "value": | ||
55 | fw_ch/fw_ch_modipl_2020/metadata/metadata_field_fw_ch_modipl_2020.csv" | 55 | fw_ch/fw_ch_modipl_2020/metadata/metadata_field_fw_ch_modipl_2020.csv" | ||
56 | } | 56 | } | ||
57 | ], | 57 | ], | ||
58 | "funding": "[{\"grant_number\": \"\", \"institution\": \" Swiss | 58 | "funding": "[{\"grant_number\": \"\", \"institution\": \" Swiss | ||
59 | Federal Office of the Environment (FOEN)\", \"institution_url\": | 59 | Federal Office of the Environment (FOEN)\", \"institution_url\": | ||
60 | \"\"}]", | 60 | \"\"}]", | ||
61 | "groups": [ | 61 | "groups": [ | ||
62 | { | 62 | { | ||
63 | "description": "", | 63 | "description": "", | ||
64 | "display_name": "eDNA", | 64 | "display_name": "eDNA", | ||
65 | "id": "c2176351-3002-4d7a-b2aa-d8509f7dbfbe", | 65 | "id": "c2176351-3002-4d7a-b2aa-d8509f7dbfbe", | ||
66 | "image_display_url": "", | 66 | "image_display_url": "", | ||
67 | "name": "edna", | 67 | "name": "edna", | ||
68 | "title": "eDNA" | 68 | "title": "eDNA" | ||
69 | } | 69 | } | ||
70 | ], | 70 | ], | ||
71 | "id": "a75accb7-c0ce-4e8f-b8cd-cbfd5de145fe", | 71 | "id": "a75accb7-c0ce-4e8f-b8cd-cbfd5de145fe", | ||
72 | "isopen": true, | 72 | "isopen": true, | ||
73 | "language": "en", | 73 | "language": "en", | ||
74 | "license_id": "cc-by-sa", | 74 | "license_id": "cc-by-sa", | ||
75 | "license_title": "Creative Commons Attribution Share-Alike | 75 | "license_title": "Creative Commons Attribution Share-Alike | ||
76 | (CC-BY-SA)", | 76 | (CC-BY-SA)", | ||
77 | "license_url": "https://creativecommons.org/licenses/by-sa/4.0/", | 77 | "license_url": "https://creativecommons.org/licenses/by-sa/4.0/", | ||
78 | "maintainer": "{\"affiliation\": \"\", \"email\": | 78 | "maintainer": "{\"affiliation\": \"\", \"email\": | ||
79 | \"virginie.marques@wsl.ch\", \"given_name\": \"Virginie\", | 79 | \"virginie.marques@wsl.ch\", \"given_name\": \"Virginie\", | ||
80 | \"identifier\": \"\", \"name\": \"Marques\"}", | 80 | \"identifier\": \"\", \"name\": \"Marques\"}", | ||
81 | "maintainer_email": null, | 81 | "maintainer_email": null, | ||
82 | "metadata_created": "2023-09-27T15:45:08.884683", | 82 | "metadata_created": "2023-09-27T15:45:08.884683", | ||
t | 83 | "metadata_modified": "2024-06-14T12:52:45.641973", | t | 83 | "metadata_modified": "2024-06-14T12:55:37.324123", |
84 | "name": | 84 | "name": | ||
85 | "environmental-dna-freshwater-switzerland-vaudcatchment-modipl-2020", | 85 | "environmental-dna-freshwater-switzerland-vaudcatchment-modipl-2020", | ||
86 | "notes": "Catchment-based sampling of river eDNA integrates | 86 | "notes": "Catchment-based sampling of river eDNA integrates | ||
87 | terrestrial and aquatic biodiversity of alpine landscapes\r\n\r\nFrom | 87 | terrestrial and aquatic biodiversity of alpine landscapes\r\n\r\nFrom | ||
88 | 22-Jun-2020 to 26-Jun-2020, we sampled five sites comprising one low, | 88 | 22-Jun-2020 to 26-Jun-2020, we sampled five sites comprising one low, | ||
89 | two intermediate and two high-elevation sites per catchment (Fig. 1a). | 89 | two intermediate and two high-elevation sites per catchment (Fig. 1a). | ||
90 | We visited two catchments per day\u2014one in the morning and one in | 90 | We visited two catchments per day\u2014one in the morning and one in | ||
91 | the afternoon\u2014for a total of ten catchments. All samples per | 91 | the afternoon\u2014for a total of ten catchments. All samples per | ||
92 | catchment were collected within a maximum four-hour period by three | 92 | catchment were collected within a maximum four-hour period by three | ||
93 | groups of samplers. The intermediate and high-elevation sites were | 93 | groups of samplers. The intermediate and high-elevation sites were | ||
94 | situated along two tributaries leading into the low-elevation site of | 94 | situated along two tributaries leading into the low-elevation site of | ||
95 | the river. We used three filters for each relative elevation class and | 95 | the river. We used three filters for each relative elevation class and | ||
96 | filtered 60 L per relative elevation class. We sampled 30 L per | 96 | filtered 60 L per relative elevation class. We sampled 30 L per | ||
97 | tributary for a combined volume of 60 L at the intermediate and | 97 | tributary for a combined volume of 60 L at the intermediate and | ||
98 | high-elevation sites. In total, 180 L were sampled in total per | 98 | high-elevation sites. In total, 180 L were sampled in total per | ||
99 | catchment. A filtration device composed of either the Athena\u00ae | 99 | catchment. A filtration device composed of either the Athena\u00ae | ||
100 | peristaltic pump (Proactive Environmental Products LLC; 1 L/min | 100 | peristaltic pump (Proactive Environmental Products LLC; 1 L/min | ||
101 | nominal flow) or the Subspace\u00ae underwater peristaltic pump | 101 | nominal flow) or the Subspace\u00ae underwater peristaltic pump | ||
102 | (Subspace Pictures; 1 L/min nominal flow), combined with a | 102 | (Subspace Pictures; 1 L/min nominal flow), combined with a | ||
103 | VigiDNA\u00ae 0.2 \u00b5M cross-flow filtration capsule (VigiDNA, | 103 | VigiDNA\u00ae 0.2 \u00b5M cross-flow filtration capsule (VigiDNA, | ||
104 | SPYGEN) was used in order to filter a large water volume. We used a | 104 | SPYGEN) was used in order to filter a large water volume. We used a | ||
105 | finer mesh than the recommended VigiDNA\u00ae 0.45 \u00b5M cross-flow | 105 | finer mesh than the recommended VigiDNA\u00ae 0.45 \u00b5M cross-flow | ||
106 | filtration capsule to maximise the capture of biological material | 106 | filtration capsule to maximise the capture of biological material | ||
107 | since mountain water does not transport high quantities of sediments. | 107 | since mountain water does not transport high quantities of sediments. | ||
108 | For each filtration capsule, we used disposable sterile tubing. At the | 108 | For each filtration capsule, we used disposable sterile tubing. At the | ||
109 | end of each filtration, we emptied the water inside the capsules, | 109 | end of each filtration, we emptied the water inside the capsules, | ||
110 | replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored | 110 | replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored | ||
111 | it at room temperature. We followed a strict contamination control | 111 | it at room temperature. We followed a strict contamination control | ||
112 | protocol in both field and laboratory stages (Goldberg et al. 2016; | 112 | protocol in both field and laboratory stages (Goldberg et al. 2016; | ||
113 | Valentini et al. 2016). Each water sample was processed using | 113 | Valentini et al. 2016). Each water sample was processed using | ||
114 | disposable gloves and single-use filtration equipment. We used two | 114 | disposable gloves and single-use filtration equipment. We used two | ||
115 | primer sets targeting vertebrates (Vert01, forward: \u2212 | 115 | primer sets targeting vertebrates (Vert01, forward: \u2212 | ||
116 | TTAGATACCCCACTATGC, reverse: \u2212 TAGAACAGGCTCCTCTAG, mean marker | 116 | TTAGATACCCCACTATGC, reverse: \u2212 TAGAACAGGCTCCTCTAG, mean marker | ||
117 | length: 97 bp) and spermatophytes (g-h/Sper01, forward: \u2212 | 117 | length: 97 bp) and spermatophytes (g-h/Sper01, forward: \u2212 | ||
118 | GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker | 118 | GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker | ||
119 | length: 48 bp). Though both primers are relatively broad with low | 119 | length: 48 bp). Though both primers are relatively broad with low | ||
120 | species-level resolution, we selected them as the goal was to minimise | 120 | species-level resolution, we selected them as the goal was to minimise | ||
121 | cost and effort and maximise the identification of a broad range of | 121 | cost and effort and maximise the identification of a broad range of | ||
122 | taxa which can represent the species assemblages of the region. | 122 | taxa which can represent the species assemblages of the region. | ||
123 | Libraries were prepared with ligation using the MetaFast protocol | 123 | Libraries were prepared with ligation using the MetaFast protocol | ||
124 | (Fasteris). ", | 124 | (Fasteris). ", | ||
125 | "num_resources": 1, | 125 | "num_resources": 1, | ||
126 | "num_tags": 7, | 126 | "num_tags": 7, | ||
127 | "organization": { | 127 | "organization": { | ||
128 | "approval_status": "approved", | 128 | "approval_status": "approved", | ||
129 | "created": "2018-12-01T11:59:01.791513", | 129 | "created": "2018-12-01T11:59:01.791513", | ||
130 | "description": "We are an international research team with diverse | 130 | "description": "We are an international research team with diverse | ||
131 | scientific expertise and backgrounds, connected by the goal to | 131 | scientific expertise and backgrounds, connected by the goal to | ||
132 | understand biodiversity. We study the mechanisms that shape | 132 | understand biodiversity. We study the mechanisms that shape | ||
133 | biodiversity patterns across spatial and temporal scales - in both | 133 | biodiversity patterns across spatial and temporal scales - in both | ||
134 | terrestrial and aquatic ecosystems -\u200bsuch as mountain ranges and | 134 | terrestrial and aquatic ecosystems -\u200bsuch as mountain ranges and | ||
135 | tropical reefs. We use an interdisciplinary approach, whereby we | 135 | tropical reefs. We use an interdisciplinary approach, whereby we | ||
136 | bridge ecology, evolution, Earth history and global change.\r\nTo make | 136 | bridge ecology, evolution, Earth history and global change.\r\nTo make | ||
137 | these connections, we collect data through biological monitoring, | 137 | these connections, we collect data through biological monitoring, | ||
138 | environmental DNA methods, remote sensing, and field sampling, and use | 138 | environmental DNA methods, remote sensing, and field sampling, and use | ||
139 | these data to answer questions with statistical and | 139 | these data to answer questions with statistical and | ||
140 | process-\u200bbased models of biological diversity.\r\nOur group is | 140 | process-\u200bbased models of biological diversity.\r\nOur group is | ||
141 | affiliated with ETH and WSL, but is also associated with Agroscope, | 141 | affiliated with ETH and WSL, but is also associated with Agroscope, | ||
142 | EAWAG, the European Joint Research Centre and Vogelwarte.", | 142 | EAWAG, the European Joint Research Centre and Vogelwarte.", | ||
143 | "id": "153392ee-d556-4b16-a330-dedb177e87f9", | 143 | "id": "153392ee-d556-4b16-a330-dedb177e87f9", | ||
144 | "image_url": | 144 | "image_url": | ||
145 | le.ethz.ch/_jcr_content/orgbox/image.imageformat.logo.1254626489.png", | 145 | le.ethz.ch/_jcr_content/orgbox/image.imageformat.logo.1254626489.png", | ||
146 | "is_organization": true, | 146 | "is_organization": true, | ||
147 | "name": "ele-group", | 147 | "name": "ele-group", | ||
148 | "state": "active", | 148 | "state": "active", | ||
149 | "title": "Ecosystems and Landscape Evolution", | 149 | "title": "Ecosystems and Landscape Evolution", | ||
150 | "type": "organization" | 150 | "type": "organization" | ||
151 | }, | 151 | }, | ||
152 | "owner_org": "153392ee-d556-4b16-a330-dedb177e87f9", | 152 | "owner_org": "153392ee-d556-4b16-a330-dedb177e87f9", | ||
153 | "private": false, | 153 | "private": false, | ||
154 | "publication": "{\"publication_year\": \"2023\", \"publisher\": | 154 | "publication": "{\"publication_year\": \"2023\", \"publisher\": | ||
155 | \"EnviDat\"}", | 155 | \"EnviDat\"}", | ||
156 | "publication_state": "published", | 156 | "publication_state": "published", | ||
157 | "related_datasets": "No related data set available for this data | 157 | "related_datasets": "No related data set available for this data | ||
158 | set. ", | 158 | set. ", | ||
159 | "related_publications": "Reji Chacko, M., Altermatt, F., Fopp, F. et | 159 | "related_publications": "Reji Chacko, M., Altermatt, F., Fopp, F. et | ||
160 | al. Catchment-based sampling of river eDNA integrates terrestrial and | 160 | al. Catchment-based sampling of river eDNA integrates terrestrial and | ||
161 | aquatic biodiversity of alpine landscapes. Oecologia 202, 699\u2013713 | 161 | aquatic biodiversity of alpine landscapes. Oecologia 202, 699\u2013713 | ||
162 | (2023). https://doi.org/10.1007/s00442-023-05428-4", | 162 | (2023). https://doi.org/10.1007/s00442-023-05428-4", | ||
163 | "relationships_as_object": [], | 163 | "relationships_as_object": [], | ||
164 | "relationships_as_subject": [], | 164 | "relationships_as_subject": [], | ||
165 | "resource_type": "dataset", | 165 | "resource_type": "dataset", | ||
166 | "resource_type_general": "dataset", | 166 | "resource_type_general": "dataset", | ||
167 | "resources": [ | 167 | "resources": [ | ||
168 | { | 168 | { | ||
169 | "cache_last_updated": null, | 169 | "cache_last_updated": null, | ||
170 | "cache_url": null, | 170 | "cache_url": null, | ||
171 | "created": "2024-06-14T08:28:38.204889", | 171 | "created": "2024-06-14T08:28:38.204889", | ||
172 | "description": "", | 172 | "description": "", | ||
173 | "doi": "", | 173 | "doi": "", | ||
174 | "format": "csv + fastq", | 174 | "format": "csv + fastq", | ||
175 | "hash": "", | 175 | "hash": "", | ||
176 | "id": "71529ec6-c98e-4bb0-b1c8-8117de89d990", | 176 | "id": "71529ec6-c98e-4bb0-b1c8-8117de89d990", | ||
177 | "last_modified": "2024-06-14T10:28:58.367000", | 177 | "last_modified": "2024-06-14T10:28:58.367000", | ||
178 | "metadata_modified": "2024-06-14T11:35:42.390602", | 178 | "metadata_modified": "2024-06-14T11:35:42.390602", | ||
179 | "mimetype": null, | 179 | "mimetype": null, | ||
180 | "mimetype_inner": null, | 180 | "mimetype_inner": null, | ||
181 | "name": "Data access", | 181 | "name": "Data access", | ||
182 | "package_id": "a75accb7-c0ce-4e8f-b8cd-cbfd5de145fe", | 182 | "package_id": "a75accb7-c0ce-4e8f-b8cd-cbfd5de145fe", | ||
183 | "position": 0, | 183 | "position": 0, | ||
184 | "publication_state": "", | 184 | "publication_state": "", | ||
185 | "resource_size": "{\"size_units\": \"gb\", \"size_value\": | 185 | "resource_size": "{\"size_units\": \"gb\", \"size_value\": | ||
186 | \"1\"}", | 186 | \"1\"}", | ||
187 | "resource_type": null, | 187 | "resource_type": null, | ||
188 | "restricted": "{\"allowed_users\": \"\", \"level\": \"public\", | 188 | "restricted": "{\"allowed_users\": \"\", \"level\": \"public\", | ||
189 | \"shared_secret\": \"\"}", | 189 | \"shared_secret\": \"\"}", | ||
190 | "size": null, | 190 | "size": null, | ||
191 | "state": "active", | 191 | "state": "active", | ||
192 | "url": | 192 | "url": | ||
193 | ?bucket=https://envicloud.wsl.ch/edna&prefix=fw_ch/fw_ch_modipl_2020", | 193 | ?bucket=https://envicloud.wsl.ch/edna&prefix=fw_ch/fw_ch_modipl_2020", | ||
194 | "url_type": null | 194 | "url_type": null | ||
195 | } | 195 | } | ||
196 | ], | 196 | ], | ||
197 | "spatial": | 197 | "spatial": | ||
198 | 838],[10.49203,47.80838],[10.49203,45.81802],[5.95587,45.81802]]]}]}", | 198 | 838],[10.49203,47.80838],[10.49203,45.81802],[5.95587,45.81802]]]}]}", | ||
199 | "spatial_info": "Switzerland", | 199 | "spatial_info": "Switzerland", | ||
200 | "state": "active", | 200 | "state": "active", | ||
201 | "subtitle": "", | 201 | "subtitle": "", | ||
202 | "tags": [ | 202 | "tags": [ | ||
203 | { | 203 | { | ||
204 | "display_name": "ENVIRONMENTAL DNA", | 204 | "display_name": "ENVIRONMENTAL DNA", | ||
205 | "id": "db7d5622-d1fc-4d24-91f7-73842c6743b6", | 205 | "id": "db7d5622-d1fc-4d24-91f7-73842c6743b6", | ||
206 | "name": "ENVIRONMENTAL DNA", | 206 | "name": "ENVIRONMENTAL DNA", | ||
207 | "state": "active", | 207 | "state": "active", | ||
208 | "vocabulary_id": null | 208 | "vocabulary_id": null | ||
209 | }, | 209 | }, | ||
210 | { | 210 | { | ||
211 | "display_name": "FRESHWATER", | 211 | "display_name": "FRESHWATER", | ||
212 | "id": "4390ca36-fb15-49f4-a9de-e800c09ccafa", | 212 | "id": "4390ca36-fb15-49f4-a9de-e800c09ccafa", | ||
213 | "name": "FRESHWATER", | 213 | "name": "FRESHWATER", | ||
214 | "state": "active", | 214 | "state": "active", | ||
215 | "vocabulary_id": null | 215 | "vocabulary_id": null | ||
216 | }, | 216 | }, | ||
217 | { | 217 | { | ||
218 | "display_name": "SPER01", | 218 | "display_name": "SPER01", | ||
219 | "id": "31a3b90b-318d-4101-b1a3-07ec904d3714", | 219 | "id": "31a3b90b-318d-4101-b1a3-07ec904d3714", | ||
220 | "name": "SPER01", | 220 | "name": "SPER01", | ||
221 | "state": "active", | 221 | "state": "active", | ||
222 | "vocabulary_id": null | 222 | "vocabulary_id": null | ||
223 | }, | 223 | }, | ||
224 | { | 224 | { | ||
225 | "display_name": "SPERMATOPHYTES", | 225 | "display_name": "SPERMATOPHYTES", | ||
226 | "id": "3203bca2-3828-4a03-8465-1aafaa12d724", | 226 | "id": "3203bca2-3828-4a03-8465-1aafaa12d724", | ||
227 | "name": "SPERMATOPHYTES", | 227 | "name": "SPERMATOPHYTES", | ||
228 | "state": "active", | 228 | "state": "active", | ||
229 | "vocabulary_id": null | 229 | "vocabulary_id": null | ||
230 | }, | 230 | }, | ||
231 | { | 231 | { | ||
232 | "display_name": "SWITZERLAND", | 232 | "display_name": "SWITZERLAND", | ||
233 | "id": "97ac3564-bb88-46ad-9fe4-b7d606e0aa3a", | 233 | "id": "97ac3564-bb88-46ad-9fe4-b7d606e0aa3a", | ||
234 | "name": "SWITZERLAND", | 234 | "name": "SWITZERLAND", | ||
235 | "state": "active", | 235 | "state": "active", | ||
236 | "vocabulary_id": null | 236 | "vocabulary_id": null | ||
237 | }, | 237 | }, | ||
238 | { | 238 | { | ||
239 | "display_name": "VERT01", | 239 | "display_name": "VERT01", | ||
240 | "id": "b8661b84-0436-4daa-b41f-7ec911a0191c", | 240 | "id": "b8661b84-0436-4daa-b41f-7ec911a0191c", | ||
241 | "name": "VERT01", | 241 | "name": "VERT01", | ||
242 | "state": "active", | 242 | "state": "active", | ||
243 | "vocabulary_id": null | 243 | "vocabulary_id": null | ||
244 | }, | 244 | }, | ||
245 | { | 245 | { | ||
246 | "display_name": "VERTEBRATES", | 246 | "display_name": "VERTEBRATES", | ||
247 | "id": "a8e6e936-d9f5-4c8e-a961-20dafc6da3aa", | 247 | "id": "a8e6e936-d9f5-4c8e-a961-20dafc6da3aa", | ||
248 | "name": "VERTEBRATES", | 248 | "name": "VERTEBRATES", | ||
249 | "state": "active", | 249 | "state": "active", | ||
250 | "vocabulary_id": null | 250 | "vocabulary_id": null | ||
251 | } | 251 | } | ||
252 | ], | 252 | ], | ||
253 | "title": "Environmental DNA Freshwater Switzerland VaudCatchment | 253 | "title": "Environmental DNA Freshwater Switzerland VaudCatchment | ||
254 | Modipl 2020", | 254 | Modipl 2020", | ||
255 | "type": "dataset", | 255 | "type": "dataset", | ||
256 | "url": null, | 256 | "url": null, | ||
257 | "version": "1.0" | 257 | "version": "1.0" | ||
258 | } | 258 | } |