Environmental DNA Freshwater Switzerland VaudCatchment Modipl 2020

Catchment-based sampling of river eDNA integrates terrestrial and aquatic biodiversity of alpine landscapes

From 22-Jun-2020 to 26-Jun-2020, we sampled five sites comprising one low, two intermediate and two high-elevation sites per catchment (Fig. 1a). We visited two catchments per day—one in the morning and one in the afternoon—for a total of ten catchments. All samples per catchment were collected within a maximum four-hour period by three groups of samplers. The intermediate and high-elevation sites were situated along two tributaries leading into the low-elevation site of the river. We used three filters for each relative elevation class and filtered 60 L per relative elevation class. We sampled 30 L per tributary for a combined volume of 60 L at the intermediate and high-elevation sites. In total, 180 L were sampled in total per catchment. A filtration device composed of either the Athena® peristaltic pump (Proactive Environmental Products LLC; 1 L/min nominal flow) or the Subspace® underwater peristaltic pump (Subspace Pictures; 1 L/min nominal flow), combined with a VigiDNA® 0.2 µM cross-flow filtration capsule (VigiDNA, SPYGEN) was used in order to filter a large water volume. We used a finer mesh than the recommended VigiDNA® 0.45 µM cross-flow filtration capsule to maximise the capture of biological material since mountain water does not transport high quantities of sediments. For each filtration capsule, we used disposable sterile tubing. At the end of each filtration, we emptied the water inside the capsules, replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored it at room temperature. We followed a strict contamination control protocol in both field and laboratory stages (Goldberg et al. 2016; Valentini et al. 2016). Each water sample was processed using disposable gloves and single-use filtration equipment. We used two primer sets targeting vertebrates (Vert01, forward: − TTAGATACCCCACTATGC, reverse: − TAGAACAGGCTCCTCTAG, mean marker length: 97 bp) and spermatophytes (g-h/Sper01, forward: − GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker length: 48 bp). Though both primers are relatively broad with low species-level resolution, we selected them as the goal was to minimise cost and effort and maximise the identification of a broad range of taxa which can represent the species assemblages of the region. Libraries were prepared with ligation using the MetaFast protocol (Fasteris).

• Swiss Federal Office of the Environment (FOEN)

No related data set available for this data set.

Reji Chacko, M., Altermatt, F., Fopp, F. et al. Catchment-based sampling of river eDNA integrates terrestrial and aquatic biodiversity of alpine landscapes. Oecologia 202, 699–713 (2023). https://doi.org/10.1007/s00442-023-05428-4