Skip to content
Login has been disabled on EnviDat Legacy. Please log in via https://envidat.ch first, then refresh this page.

Changes

View changes from to


On August 7, 2023 at 6:48:34 AM UTC, Gravatar Administrator:
  • Changed title to Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord (previously Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord)


  • Set maintainer of Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord to {"affiliation": "", "email": "virginie.marques@wsl.ch", "given_name": "Virginie", "identifier": "", "name": "Marques"} (previously {"affiliation": "ETH", "email": "virginie.marques@wsl.ch", "given_name": "Virginie", "identifier": "", "name": "Marques"})


  • Set author of Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord to [{"affiliation": "Unit of Land Change Science, Swiss Federal Research Institute WSL, Birmensdorf, Switzerland", "affiliation_02": "Ecosystem and Landscape Evolution, Institute of Terrestrial Ecosystems, Department of Environmental Systems Science, ETH Z\u00fcrich, Z\u00fcrich, Switzerland", "affiliation_03": "", "data_credit": ["validation", "curation", "software", "publication"], "email": "virginie.marques@wsl.ch", "given_name": "Virginie", "identifier": "", "name": "Marques"}, {"affiliation": "Swiss Polar Institute, Ecole Polytechnique F\u00e9d\u00e9rale de Lausanne, Lausanne, Switzerland", "affiliation_02": "Institute of Earth Sciences, University of Lausanne, Lausanne, Switzerland", "affiliation_03": "", "data_credit": ["collection", "validation", "publication"], "email": "christelshassler@gmail.com", "given_name": "Christel", "identifier": "", "name": "Hassler"}, {"affiliation": "Environmental DNA Group, Department of Environmental Systems Science, Swiss Federal Institute of Technology (ETH) Z\u00fcrich, Z\u00fcrich, Switzerland", "affiliation_02": "", "affiliation_03": "", "data_credit": "collection", "email": "elias.meier@usys.ethz.ch", "given_name": "Elias", "identifier": "", "name": "Meier"}, {"affiliation": "Environmental DNA Group, Department of Environmental Systems Science, Swiss Federal Institute of Technology (ETH) Z\u00fcrich, Z\u00fcrich, Switzerland", "affiliation_02": "", "affiliation_03": "", "data_credit": ["validation", "publication"], "email": "alpinedna@gmail.com", "given_name": "Kristy", "identifier": "", "name": "Deiner"}, {"affiliation": "Unit of Land Change Science, Swiss Federal Research Institute WSL, Birmensdorf, Switzerland", "affiliation_02": "Landscape Ecology, Institute of Terrestrial Ecosystems, ETH Z\u00fcrich, 8049 Z\u00fcrich, Switzerland", "affiliation_03": "", "data_credit": ["publication", "supervision"], "email": "albouycamille@gmail.com", "given_name": "Camille", "identifier": "0000-0003-1629-2389", "name": "Albouy"}, {"affiliation": "Landscape Ecology, Institute of Terrestrial Ecosystems, ETH Z\u00fcrich, 8049 Z\u00fcrich, Switzerland", "affiliation_02": "Unit of Land Change Science, Swiss Federal Research Institute WSL, Birmensdorf, Switzerland", "affiliation_03": "", "data_credit": ["publication", "supervision"], "email": "loic.pellissier@wsl.ch", "given_name": "Loic", "identifier": "0000-0002-2289-8259", "name": "Pellissier"}] (previously [{"affiliation": "ETH", "affiliation_02": "WSL", "affiliation_03": "", "data_credit": ["validation", "curation", "publication"], "email": "virginie.marques@wsl.ch", "given_name": "Virginie", "identifier": "", "name": "Marques"}])


  • Updated description of Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord from

    This dataset contains the raw environmental DNA data associated with the publication "Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord". Methods - sampling We sampled the Lilliehöök fjord on the west coast of Spitsbergen (Svalbard, Norway) over 3 days from 3 to 5 of August 2021. Samples were taken from the glacier front up to the fjord mouth of the Krossfjorden system, around 30 km long, after the Lilliehöök fjord merged with the mouth of Möller fjord. The fjord’s maximum depth has been recorded at 373 m (Svendsen et al. 2002) and has no sill at its entrance, thereby facilitating water exchange with the open ocean of the West Spitsbergen Current. We used a research vessel to sample 5 sites for a total of 15 samples, sampling 3 depths per site (3-m, chlorophyll a maximum and 85-m, unless sea floor was shallower). Shallow and intermediate samples between 3-m and 12-m represent ~35-L of water filtered in-situ using long tubing and a peristaltic pump, and all other deeper samples were taken from a total of 3 Niskin bottles (General Oceanics), representing 22-L of water sampled per sample. Water was filtered through a VigiDNA filtration capsule (SPYGEN) with a 0.20-µm pore size using an Athena peristaltic pump (Proactive Environmental Products, Bradenton, Florida) with a flow rate of ~1-L/min. Each sample was handled with single use tubing and gloves. Methods - molecular To perform the amplification, we used two sets of primers: teleo (forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG; Valentini et al. 2016) and the universal eukaryotic 1389F/1510R primer pair, amplifying the V9-18S rDNA gene (Amaral-Zettler et al. 2009) (forward: TTGTACACACCGCCC, reverse: CCTTCYGCAGGTTCACCTAC). For more details, see the Methods in the associated publication: LINK Data content: *Environmental DNA sequencing data* Here we present the raw data after demultiplexing using _cutadapt_ with no mismatch allowed.
    to
    This dataset contains the raw environmental DNA data associated with the publication *Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord* in the journal Polar Biology (2023). # Methods **Sampling** We sampled the Lilliehöök fjord on the west coast of Spitsbergen (Svalbard, Norway) over 3 days from 3 to 5 of August 2021. Samples were taken from the glacier front up to the fjord mouth of the Krossfjorden system, around 30 km long, after the Lilliehöök fjord merged with the mouth of Möller fjord. The fjord’s maximum depth has been recorded at 373 m (Svendsen et al. 2002) and has no sill at its entrance, thereby facilitating water exchange with the open ocean of the West Spitsbergen Current. We used a research vessel to sample 5 sites for a total of 15 samples, sampling 3 depths per site (3-m, chlorophyll a maximum and 85-m, unless sea floor was shallower). Shallow and intermediate samples between 3-m and 12-m represent ~35-L of water filtered in-situ using long tubing and a peristaltic pump, and all other deeper samples were taken from a total of 3 Niskin bottles (General Oceanics), representing 22-L of water sampled per sample. Water was filtered through a VigiDNA filtration capsule (SPYGEN) with a 0.20-µm pore size using an Athena peristaltic pump (Proactive Environmental Products, Bradenton, Florida) with a flow rate of ~1-L/min. Each sample was handled with single use tubing and gloves. **Molecular** To perform the amplification, we used two sets of primers: teleo (forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG; Valentini et al. 2016) and the universal eukaryotic 1389F/1510R primer pair, amplifying the V9-18S rDNA gene (Amaral-Zettler et al. 2009) (forward: TTGTACACACCGCCC, reverse: CCTTCYGCAGGTTCACCTAC). # Data content: + Metabarcoding data: This zip file contains the 2 sequencing libraries filtered to only retain the samples used in the present study. + Code, data and figure: This zip file contains all data and code to reproduce the figures and the analysis in the study, with an associated README explaining the content of each folder. # Additional informations For more details, please see the Methods in the associated publication: DOI: 10.1007/s00300-023-03187-9.


  • Changed value of field publication_state to approved in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Changed value of field related_publications to https://link.springer.com/article/10.1007/s00300-023-03187-9, DOI: 10.1007/s00300-023-03187-9 in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Added resource Code, data and figures to Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Deleted resource Field metadata from Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Set format of resource Metabarcoding data to ZIP in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Updated description of resource Metabarcoding data in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord from

    Raw demultiplexed metabarcoding data for both primers (teleo and 18S)
    to
    Raw demultiplexed metabarcoding data for both primers (teleo and 18S) and corresponding file to perform the demultiplexing and primer trimming


  • Uploaded a new file to resource Metabarcoding data in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord


  • Changed value of field url_type to upload in resource Metabarcoding data in Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord